Applied Biosystems - Product and Service Literature

Support

Contact Support FAQs Tools Tutorials & Troubleshooting Software Downloads, Patches & Updates Software Community Program

Product & Technical Literature

Select a tab below to find and order the documents you need. To view a PDF, please download the newest version of Adobe® Reader.

Application Notes & Tutorials (9) Articles & White Papers (6) Brochures & Specifications (64) Case Studies (1) Manuals (28) Newsletters (4) Posters (2) Protocols (77) References (8)

The lock icon

indicates a document that requires registration for download.
* Hard Copy require registration for document delivery.

Reset Deliver Selected Documents

Application Notes & Tutorials (9)

Title	Size	Pages
POROS Protein A, G, and CaptureSelect Affinity Columns Part #: n/a POROS® Protein A, Protein G, and CaptureSelect® ligands target multiple IgG epitopes. The graphic shows the binding sites for affinity ligands Protein A and Protein G.	3723 KB	4
Optimized blood plasma protocol for profiling miRNA using the OpenArray system Stock #: CO31609 Real-Time PCR System enables researchers to profile well-characterized and well-studied miRNAs for high-throughput cancer biomarker discovery research, miRNA regulation of mRNA gene expression, and miRNA functional analysis.	435 KB	4
Single-cell profiling on the OpenArray Real-Time PCR System Stock #: CO23010 Gene expression profiling using real-time PCR is a pivotal tool for molecular genomics. Typically, RNA or DNA samples originate from tissue composed of heterogeneous cell populations.	1346 KB	8
How to Use the Buccal DNA Collector Remove the Buccal DNA Collector from the pouch, holding the handle at the base. Move Slider Cover back if necessary to fully expose the Collection Paper. Instruct the subject to hold the Buccal DNA Collector and put thumb on the area marked “Thumb” on the back of the Collector.	856 KB	1
Accurate and Sensitive Mutation Detection and Quantification using TaqMan Mutation Detection Assays Part #: CO31540 In this research study, we addressed the feasibility of obtaining sensitive, accurate, and reproducible mutation detection results in synthetic templates, cell lines, and FFPE tissue samples using TaqMan® Mutation Detection Assays.	1697 KB	1
Protocol using low sample input for miRNA quantitation on the OpenArray system Stock #: CO16851 RT primer pools. However, in certain situations where RNA yield is limited, such as with laser capture microdissection or needleaspiration biopsies, allowing reduced RNA input is desirable. We have developed a Low Sample Input (LSI) protocol for these types of reduced-yield samples. To	244 KB	4
OpenArray digital PCR for virology research - beyond Ct Stock #: CO31354 However, there are times when qPCR results are ambiguous or inconclusive. Sensitivity or precision may be limited, for example, by extremely low levels of virus. This can cause researchers anxiety and uncertainty over the possibility of virus present but at levels too low to detect.	1887 KB	8
Attune® Cytometer Applications: Apoptosis Stock #: CO23104 Annexin V conjugates In apoptotic cells, phosphatidylserine (PS) is translocated from the inner to the outer leaflet of the plasma membrane, thus exposing PS to the external cellular environment.	1128 KB	5
Protein Thermal Shift Application Note Stock #: CO31346 The Protein Thermal Shift™ assay measures protein thermal stability using a fluorescent proteinbinding dye. Protein Thermal Shift™ experiments are conducted utilizing the melt capability of Applied Biosystems® real-time PCR systems.	3177 KB	6

Articles & White Papers (6)

Title	Size	Pages
OpenArray system publications on genotyping and real-time PCR Stock #: CO31943 Yeung EH, Cuilin Z et al. (2011) Polymorphisms in the neuropeptide Y gene and the risk of obesity: findings from two prospective cohorts. J Clin Endocrinol Metab 96: E2055–E2062. Qi L, Parast L et al.	210 KB	4
Fast real-time PCR is optimized real-time PCR Stock #: CO13159 Reduced DNA polymerase activation time “Hot-start” thermostable DNA polymerases are strongly recommended for use in real-time PCR. These enzymes are inactive at room temperature and require a heat activation step to become active.	739 KB	4
GenomeWeb article UCD MiSeq data Validated by Sanger Sequencing IN ANTICIPATION of a clinical trial involving targeting sequencing of patients with metastatic breast cancer, researchers at the University of California, San Diego, have published some of the ﬁrst human data using the Illumina MiSeq instrument.	135 KB	2
Life Technologies Submits Sequencer and HLA Typing Kits to FDA for Diagnostic Use-press release 3500 Dx Genetic Analyzer, SeCore® Kits, and uTYPE® Software to raise the standard in sequenced-based HLA typing to identify gene variations commonly used in compatibility selection for transplantation CARLSBAD, Calif.	31 KB	1
Life Technologies and Gen-Probe to Collaborate on Sequencing-Based Assays Under terms of the agreement, Gen-Probe will commercialize future sequencing-based diagnostic assays and fragment analysis-based human diagnostic genetic tests to be used on the Life Technologies 3500 Dx Series Genetic Analyzers.	121 KB	1
LT Initiates Clinical Trials Leading to 510(k) Submission of a Class I and Class II HLA SBT Solution- Press release If cleared, Life’s 3500 Dx Genetic Analyzer and SeCore® HLA Sequencing kits would constitute the first 510(k)-cleared sequence-based test for HLA typing in the United States	53 KB	1

Brochures & Specifications (64)

Title	Size	Pages
SNaPshot SNP Analysis product bulletin Stock #: CO110582 Multiplex Kit uses a single-tube reaction to interrogate SNPs at known locations. The chemistry is based on the dideoxy single-base extension of an unlabeled oligonucleotide primer (or primers).	423 KB	4
Power SYBR® Green PCR Master Mix and Power SYBR® Green RNA-to-CT™ 2-Step Kit Stock #: CO16930 2-Step Kit deliver highly sensitive DNA, cDNA, and RNA quantitation, detecting as few as 2 copies of a target gene over a broad range of template concentrations. The Power SYBR ® Green PCR Master Mix offers significantly improved sensitivity by employing a highly purified AmpliTaq Gold ®	747 KB	4
TaqMan® Universal Master Mix II Stock #: CO16924 Universal Master Mix II brings the quality and reliability you’ve come to expect from Applied Biosystems to a new, improved master mix formulation for real-time PCR.	543 KB	4
MeltDoctor High Resolution Melt Reagents Stock #: CO16932 High-resolution melting (HRM) analysis is a post-PCR analysis method used to identify variation in nucleic acid sequences. The method is based on detecting small differences in PCR melting (dissociation) curves.	1056 KB	4
Fast SYBR® Green Master Mix Stock #: CO16936 Green Master Mix delivers highly sensitive and reproducible real-time PCR results in less than half the time when used with Applied Biosystems® fast-enabled real-time PCR instruments. The Fast master mix also offers high specificity by employing the new highly purified AmpliTaq®	2267 KB	4
Custom TaqMan® Array Cards Stock #: CO01513 Array Card is a 384-well microfluidic card that enables you to perform 384 simultaneous realtime PCR reactions without the need for liquid-handling robots or multi-channel pipettors to load samples. This highly flexible card enables 1 to 8 samples to be run in parallel against 12 to 384 TaqMan®	1598 KB	6
POROS Affinity Chromatography Columns Product Bulletin Part #: CO24355 Analytical groups supporting biological drug development efforts require rapid, sensitive, and precise methods for quantifying proteins from cell cultures, fermentation harvests, or purification intermediates.	939 KB	4
QuantStudio 12K Flex Product Brochure Part #: CO31611 96-well blocks. Block changes typically take less than 1 minute and require no tools, providing the ultimate in format flexibility. Achieve consistent, high-quality results across different plating formats as your research progresses. Scales to your research	2403 KB	20
TaqMan PreAmp Master Mix Stock #: CO110510 To overcome this, methods to preamplify the RNA or cDNA have been developed. These methods, however, are limited in their effectiveness because they inconsistently amplify the starting material, resulting in biased and inaccurate amplification of some transcripts.	405 KB	4
TaqMan® Copy Number Assays Product Family Stock #: CO110508 Human genomes vary from one another at the genetic level. Some genetic variations are large, structural, chromosomal variations, while others occur at the singlenucleotide level. A structural variation that has been described in recent years is “copy number variation” (CNV).	1020 KB	4
Brochure:Ion PGM and Proton Sequencers Part #: CO31911 At the heart of every Ion Torrent™ sequencer is a powerful semiconductor chip. By increasing the density of wells in each generation of chips, Ion Torrent™ sequencers have realized a 100-fold increase in speed and throughput in just their first year. < ION SemIcONductOr SequeNcINg \| 01	1704 KB	12
TaqMan® Fast Advanced Master Mix Stock #: CO01509 • Best-in-class performance—superior sensitivity, accuracy, dynamic range, and specificity compared to standard mixes in standard mode • Engineered for enhanced benchtop stability—stable at room temperature for up to 72 hours in preassembled reactions	586 KB	4
Specification Sheet - Ion PGM Sequencer Sequencer performs real-time measurements of hydrogen ions produced during DNA replication. Ion semiconductor chips employ a massively parallel array of semiconductor sensors to directly translate genetic information (DNA) to digital information (DNA sequence).	334 KB	4
Ion AmpliSeq Cancer Panel Mutation List (1.0) Spreadsheet ǂ Ion AmpliSeq Cancer Panel Mutatǂ Geneǂ accession numberǂ COSMIC idǂ cds_mut_syntaxǂ aa_mut_syntaxǂ Strandǂ hg19 coordinatesǂ Insertǂ Target_urlǂ ABL1ǂ X16416ǂ c.730A>Gǂ p.M244Vǂ ǂ 9:133738330-133738330ǂ GGCAGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACǂ	265 KB	1
Green Feature Fact Sheet: UltraPure™ Agarose Products Part #: CO21121 Life Technologies is committed to designing our products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that these products’ packaging uses less material than their preceding packaging design.	187 KB	1
Green Feature Fact Sheet: Molecular Probes® Pouches Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this products’ packaging uses less material than its preceding packaging design.	163 KB	1
Green Feature Fact Sheet: MagicMedia™ E. coli Expression Medium SoluPouch™ Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product utilizes sustainable packaging principles. The MagicMedia™ E.	161 KB	1
Green Feature Fact Sheet: GIBCO® Media Bottles Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product utilizes sustainable packaging principles.	167 KB	2
Green Feature Fact Sheet: Ambion® Cells-to-Ct™ Kits Part #: CO21121 ™ kits include reagents and enzyme mixtures for reverse transcription (RT) and real-time PCR directly from cultured cell lysates, without the need for a separate RNA isolation step. Green Features	205 KB	2
Green Feature Fact Sheet: SimplyBlue™ SafeStain Part #: CO21121 Life Technologies is committed to designing our products with the environment in mind— it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product is less hazardous than comparable products. The use of SimplyBlue™	181 KB	2
Green Feature Fact Sheet: Click-iT® Detection Assays Part #: CO21121 The use of Click-iT® detection assays provides an alternative to exposure to radiation for performing common cellular and biochemical analyses, including detection of cell proliferation and monitoring of protein synthesis and metabolism using the isotopes 3 H-thymidine and 35	152 KB	1
Green Feature Fact Sheet: 7300/7500 Real-Time PCR Systems Part #: CO21121 Environmental benefits include reduced use of resources for packaging, thereby improving the packing density and weight, and decreasing greenhouse gas emissions from transport of the same amount of product. Furthermore, less packaging waste is generated at endof-life. Product Description	197 KB	2
Green Feature Fact Sheet: SimplyBlue™ SafeStain Part #: CO21121 Life Technologies is committed to designing our products with the environment in mind— it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product is less hazardous than comparable products. The use of SimplyBlue™	181 KB	2
Green Feature Fact Sheet: PureLink™ Quick Gel Extraction Kit Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product is now less hazardous than its preceding product.	165 KB	1
Green Feature Fact Sheet: NovaBright™ Chemiluminescent SEAP Reporter Gene Assay 2.0 Kits Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product is now less hazardous than its preceding product, the NovaBright™	164 KB	1
Green Feature Fact Sheet: PureLink™ DNA Stabilization Reagent Part #: CO21121 DNA Stabilization Reagent can be stored and shipped at a range of temperatures (–80°C to 76°C). This eliminates the need for dedicated freezer space and associated energy use, as well as the use of dry ice and EPS coolers, should there be a need for transport. Product Description	162 KB	1
Green Feature Fact Sheet: SYBR® Safe DNA Gel Stain Part #: CO21121 Life Technologies is committed to designing products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product is less hazardous than the traditional method of DNA staining. SYBR®	176 KB	2
Green Feature Fact Sheet: Click-iT® DIBO Detection and Labeling Reagents Part #: CO16480 Life Technologies is committed to designing our products with the environment in mind—it’s one more step toward a smaller footprint. Using Click-iT®	152 KB	1
Application Note: Ion AmpliSeq Cancer Panel Part #: CO01585 Targeted resequencing can be utilized for efficient sequencing of specific genes or genomic regions. Current target selection methods are lengthy, complex, and usually require large amounts of input DNA.	762 KB	4
TaqMan® SNP Genotyping Assays Stock #: CO01515 Assays have the simplest workflow available and are the quickest way to generate genotyping data. Based on powerful TaqMan® probe and primer chemistry and designs, and coupled to dependable Applied Biosystems® instruments and software, these made-to-order assays produce high-confidence results.	2738 KB	6
BDD CTRL YIR for detection of mutations in NSCLC Researchers at the Clinical and Translational Research Core Lab (CTRL), Department of Pathology at the Medical College of Wisconsin in Milwaukee, Wisconsin, are using human tissue samples to perform translational research in order to better understand the underlying mechanisms of disease.	2117 KB	4
Buccal DNA Collector™ Product Brochure Human identification laboratories are coping with an increasing volume of reference samples requiring processing for forensic DNA databases, paternity analysis and other applications.	817 KB	4
TargetSeq™ Exome and Custom Enrichment Kit product bulletin Stock #: CO01309	518 KB	4
Validation Certificate: AmpFlSTR® Identifiler® Direct PCR Amplification Kit Direct PCR Ampliﬁcation Kit for use in Human Identiﬁcation testing for databasing, and paternity applications. Each laboratory using the AmpFlSTR® Identiﬁler® Direct PCR Ampliﬁcation Kit should perform its own appropriate internal validation studies to establish interpretation CO01323	161 KB	1
Product Bulletin: AmpFlSTR® Identifiler® Direct PCR Amplification Kit Forensic DNA databases are being created or expanded in many countries worldwide. For example, the National DNA Index System (NDIS) in the United States now contains more than 10 million offender DNA profiles.	913 KB	4
Prep-N-Go Flyer Buffer is a best-inclass solution designed to enable high quality direct PCR amplification of non-FTA® reference samples without the need for heat incubation, extraction or purification. Prep-n-Go™	1353 KB	4
Prep-N-Go Product Insert Prep-n-Go™ Buffer (Part no. 4467079) is optimized for use with the AmpFlSTR® Identifiler® Direct PCR Amplification Kit (200 reaction kit Part no. 4467831; 1000 reaction kit Part no. 4408580).	149 KB	2
PrepFiler Product Bulletin The quantity and quality of genomic DNA extracted from a forensic sample can greatly impact the success of the sample analysis process and the overall quality of the final result.	811 KB	4
Validation Certificate: PrepFiler® Automated Forensic DNA Extraction Kit Life Technologies has validated these kits for use in Human Identiﬁcation testing for databasing, casework, and paternity applications.	155 KB	1
Product Flyer: PrepFiler®and PrepFiler® BTA Forensic DNA Extraction Kits The “BTA” stands for “Bone, Tooth, and Adhesives.” This kit has been developed for the extraction of DNA from calcified tissues (bone, tooth), as well as certain adhesive-containing samples such as cigarette butts, tapelifts and envelope flaps.	1769 KB	4
Discontinuation Letter High Capacity RNA-to-cDNA Master Mix Part #: Marketing Material Dear valued customer, After careful consideration, Life Technologies has decided to discontinue the manufacture and sale of High Capacity RNA‐to‐cDNA™ Master Mix effective December 31, 2011.	90 KB	2
Specification Sheet: Ion OneTouch System Instrument are three breakthrough technologies that enable automated delivery of templated Ion Sphere™ particles. The first is the reaction filter that creates millions of microreactors in which clonal amplification occurs.	1120 KB	1
Green Fact Sheet: AmpliTaq Gold® 360 and AmpliTaq® 360 DNA Polymerases Part #: CO19451 In order to minimize the adverse environmental impact of packaging and shipping products on gel ice, Life Technologies investigated the feasibility of shipping its AmpliTaq Gold® 360 and AmpliTaq® 360 DNA Polymerases at ambient temperature.	160 KB	2
Attune Acoustic Focusing Cytometer Green Feature Fact Sheet Part #: CO16487 Life Technologies is committed to designing our products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product produces less hazardous waste than traditional flow cytometry methodology.	152 KB	1
User Bulletin: Applied Biosystems 3500/3500xL Genetic Analyzer Part #: 4445098 Rev A Related documentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 Section 1 Troubleshooting issues . . . . . . . . . .	2549 KB	40
Attune Acoustic Focusing Cytometer Green Fact Sheet Part #: CO164870611 Life Technologies is committed to designing our products with the environment in mind—it’s one more step toward a smaller footprint. This fact sheet provides the rationale behind the environmental claim that this product produces less hazardous waste than traditional flow cytometry methodology.	152 KB	1
LifeScopeGenomicAnalysisSolutions Spec Sheet Stock #: CO 01193 Oct 11 Genomic Analysis Solutions build on the accuracy of the 5500 Series Genetic Analyzers with Exact Call Chemistry (ECC), bringing you system-optimized algorithms to generate high-quality data. You can work directly in base space with LifeScope™	1398 KB	4
OpenArray® technology on the QuantStudio 12K Flex Real-Time PCR System Stock #: CO23802 easy-to-use format. For most applications, assays are preloaded onto plates at our state-of-the-art manufacturing facility. To run the plates, simply mix your sample with master mix, load with the automated QuantStudio™ 12K Flex OpenArray® AccuFill™	1532 KB	6
QuantStudio 12K Flex REal-Time PCR System with OpenArray Block Stock #: CO23804 A wide variety of fixed-content and fully customizable plates are available to meet a broad spectrum of research needs. For more information about plate formats, refer to the product bulletin OpenArray® technology on the QuantStudio™ 12K Flex Real-Time PCR System at www.appliedbiosystems.	218 KB	2
Quick Reference Card: SOLiD™ EZ Bead™ Amplifier Part #: 4443495 Rev E Note: For safety guidelines, refer to the “Safety” section in the Applied Biosystems SOLiD® EZ Bead™ Amplifier Getting Started Guide (PN 4443494). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	537 KB	4
Application Note: Paired End Sequencing Part #: CO24084 Next-generation sequencing — based applications and methodologies are extensively used to investigate genome biology. The lengths of next-generation sequencing reads are limited by accuracy—as read length increases, accuracy decreases.	1223 KB	4
PrepSEQ® Residual DNA Sample Preparation Kit Quick Reference Guide Part #: 4468125 Reva Stock #: 4468125A Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepSEQ® Residual DNA Sample Preparation Kit Protocol (Part no. 4460663). For every chemical, read the MSDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	214 KB	8
resDNASEQ® Vero Residual DNA Data Sheet Part #: CO23032 Stock #: CO23032 Vero Residual DNA Quantitation System is a quantitative PCR (qPCR)-based system for the detection of host cell DNA from Vero cells (African green monkey), an expression system commonly used for the production of vaccines. Reliable and rapid, the system enables sensitive (LOQ = 1.	925 KB	2
resDNASEQ® Host Cell DNA Quantitation Systems:CHO, E. coli, Vero, NS0 Part #: CO21719 Host Cell Residual DNA Quantitation Systems include: • TaqMan® primer and probe mix • TaqMan® master mix • Host cell genomic DNA standard • Negative control Components of the PrepSEQ™ Residual DNA Sample Preparation Kit include: • PrepSEQ™	1250 KB	6
TargetSeq™ Custom Enrichment Kit Custom Design Request Form Part #: 4471869 Stock #: Rev. A Custom Enrichment Kits. Please complete this form in its entirety to ensure accurate processing of your order. If you have questions, contact !CBD-CSOTeam@lifetech.com. Background information • TargetSeq™	114 KB	3
Target Seq Custom Enrichment Kit Ordering Guide Part #: 4471870 Stock #: Rev. A ■ Ordering TargetSeq™ Custom Enrichment Kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 ■ Submitting custom designs to Life Technologies. . . . . . . . . . . . . . . . . . . . . . . . .	1144 KB	12
Red/blue laser flyer: Attune® Acoustic Focusing Cytometer Stock #: CO31442 0411 Acoustic Focusing Cytometer is the only one of its kind that gives you both precision and sensitivity for your precious samples and rare-event detection. Its no-wash, no-lyse method eliminates cell loss and lets you see results ten times faster than with any other cytometer.	818 KB	4
Applied Biosystems 7500 Fast Dx Real-Time PCR Instrument Stock #: CO14891 *For in vitro diagnostic use in Australia and New Zealand only. The customer is responsible for any validation of assays, and compliance with any regulatory requirements that pertain to their procedures and instrument use. PRODUCT BROCHURE	1239 KB	4
MicroSEQ ID Microbial Identification Software Part #: CO23108 Reviewing each specimen in a project file to make a manual identification call can be tedious and time consuming. The new Auto-ID feature in MicroSEQ® ID v3.0 uses a set of editable parameters to automatically identify unknown specimens.	376 KB	2
Terms and Conditions Diagenode update 2011 Article 1 - Area of Application 1.1. These general conditions are applicable to all of our sales. 1.2 Every purchaser who gives us an order in any way whatsoever will be held to have accepted these general conditions prior to giving the order. 1.	205 KB	2
3500 Dx Series Genetic Analyzer pre-launc Brochure USA Part #: CO19459 CO19459 Molokai- Instrument prelaunch brochure.indd 1 7/14/11 4:22 PM The Applied Biosystems® capillary electrophoresis platforms are the industry standard, providing the most reliable, efficient, and widely published technology for DNA sequence analysis.	3703 KB	6
Application Note: Targeted Resequencing Guide Part #: CO19872 The identification of common and rare variants in candidate regions of the human genome is essential to better understanding the etiology of complex human diseases.	667 KB	4
BDD UCSF YIR for characterizing melanoma mutations Melanoma is an aggressive skin cancer with increasing incidence worldwide [1]; it is a malignant tumor arising from pigment-producing melanocytes in the skin, eye, or mucosal surfaces.	750 KB	4
User Bulletin: Applied Biosystems 3500/3500xL Genetic Analyzer PCR Amplification kit products on the Applied Biosystems 3500 Series Genetic Analyzers, using 3500 Data Collection software Version 1.0 and GeneMapper® ID-X Software Version 1.2 or later.	3145 KB	69

Case Studies (1)

Title	Size	Pages	Hard Copy*
Sensitive KRAS Variant Detection by HRM on the Viia 7 Real-Time PCR System Part #: CO22126 Somatic mutations of the KRAS gene can lead to a form of the protein that can direct cells to grow and divide without control, implicating KRAS in the development of several types of cancer.	1193 KB	4

Manuals (28)

Title	Size	Pages
User Guide: RapidMAX Software Part #: 4469874 RevA APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	2742 KB	109
User Guide: PrepFiler and PrepFiler BTA Forensic DNA Extraction Kits Part #: 4463348 Rev C Publication Part Number 4463348 Rev. C Revision Date January 2012 For Research, Forensic, or Paternity Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	2903 KB	96
User Guide: AB Library Builder Whole Transcriptome Core Kit for 5500 Genetic Analysis Systems Part #: MAN0003622 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. COPYRIGHT © 2011, Life Technologies Corporation. All rights reserved.	1123 KB	56
Getting Started Guide: Applied Biosystems ViiA™ 7 Real-Time PCR System Part #: 4441434 Rev C Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	32935 KB	564
User Guide: SYBR® Green PCR Master Mix and RT-PCR Reagents Kit Part #: 4310251 Rev G Publication Part Number 4310251 Rev. G Revision Date September 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	661 KB	48
User Guide: PrepFiler Automated Forensic DNA Extraction Kits Part #: 4463349 Rev B Information in this document is subject to change without notice. LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	7470 KB	144
User Guide: AmpFlSTR® Identifiler® Direct PCR Amplification Kit Part #: 4415125 Rev F Publication Part Number 4415125 Rev. F Revision Date October 2011 For Research, Forensic, or Paternity Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	2617 KB	120
PrepFiler User Bulletin This user bulletin describes the developmental validation experiments performed to evaluate: • A new wash buffer, PrepFiler™ Wash Buffer B, for use with the PrepFiler™	751 KB	26
AcroMetrix KRAS FFPE Process Controls Product Insert KRAS FFPE Process Controls are intended for use in assessing the performance of the isolation, purification, and detection of nucleic acid associated with specific KRAS mutations.	151 KB	2
Getting Started Guide: SOLiD™ EZ Bead™ Amplifier Part #: 4443494 Rev E Emulsion Cleanup and Bead Enrichment Emulsion PCR Emulsion Preparation For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	2142 KB	47
User Guide: SOLiD EZ Bead System Software Installation Guide - Software Installation v1.9 Part #: 4472494 Rev A Publication Part Number 4472494 Rev. A Revision Date October 2011 For General Laboratory Use. For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	1602 KB	15
Getting Started Guide: SOLiD™ EZ Bead™ Enricher Part #: 4443496 Rev E Emulsion Cleanup and Bead Enrichment Emulsion PCR Emulsion Preparation For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	4458 KB	90
Getting Started Guide: SOLiD™ EZ Bead™ Emulsifier Part #: 4441486 Rev E Emulsion Cleanup and Bead Enrichment Emulsion PCR Emulsion Preparation For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	3354 KB	81
Quick Reference Card: SOLiD™ EZ Bead™ Enricher Part #: 4443497 Rev E Note: For safety guidelines, refer to the “Safety” section in the Applied Biosystems SOLiD® EZ Bead™ Enricher Getting Started Guide (Part no. 4443496). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	1825 KB	10
Quick Reference Card: SOLiD™ EZ Bead™ Emulsifier Part #: 4441487 Rev E Note: For safety guidelines, refer to the “Safety” section in the Applied Biosystems SOLiD® EZ Bead™ Emulsifier Getting Started Guide (Part no. 4441486). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	591 KB	6
Applied Biosystems SOLiD EZ Bead System Installation Guide Part #: 4452500 Rev B This user guide is the proprietary material of Life Technologies or its subsidiaries and is protected by laws of copyright. The customer of the SOLiD® EZ Bead™ Enricher, SOLiD® EZ Bead™ Emulsifier, and SOLiD® EZ Bead™	2377 KB	41
NGM SElect Analysis Files for GMIDX Readme ============================================================= About NGM SElect™ Kit Analysis Files v2X for GeneMapper® ID-X Software v1.0.1 and higher Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	4 KB	1
NGM SElect Analysis Files for GMID Readme ============================================================= About NGM SElect™ Kit Analysis Files v2 for GeneMapper® ID Software v3.2.1 Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	4 KB	1
NGM Analysis Files for GMID Readme ============================================================= About NGM™ Kit Analysis Files v3 for GeneMapper® ID Software v3.2.1 Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	5 KB	1
NGM Analysis Files for GMIDX Readme ============================================================= About NGM™ Kit Analysis Files v3X for GeneMapper® ID-X Software v1.0.1 and higher Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	6 KB	1
ID Direct Analysis Files for GMIDX Readme ============================================================= About Identifiler® Direct Kit Analysis Files v1 for GeneMapper® ID-X Software v1.0.1 and Higher Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	5 KB	1
ID Direct Analysis Files for GMID Readme ============================================================= About Identifiler® Direct Kit Analysis Files v1 for GeneMapper® ID Software v3.2.1 Release Notes Copyright 1999-2011, Life Technologies Corporation. All rights reserved.	5 KB	1
User Guide: Arcturus RiboAmp PLUS RNA Amplification Kit Part #: 12293-00 Rev B APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	878 KB	63
User Guide: Arcturus Paradise PLUS Reagent System Part #: 12872-00 Rev D Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	1706 KB	94
User Guide: AmpFlSTR® NGM™ PCR Amplification Kit Part #: 4425511 Rev E Publication Part Number 4425511 Rev. E Revision Date July 2011 For Research, Forensic, or Paternity Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	4974 KB	126
User Guide: Attune™ Acoustic Focusing Cytometer Publication Part Number 4453328 Rev. E Revision Date August 2011 © Copyright 2011, Life Technologies Corporation. All rights reserved. For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	9018 KB	164
FLUOROPHORE SELECTION GUIDE: Attune® Acoustic Focusing Cytometer For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. © 2011 Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. Printed in the USA. CO19941 0711	212 KB	2
AmpFlSTR COfiler® PCR Amplification Kit: User Bulletin: Rev F Part #: 4306116 NOTICE TO PURCHASER: LIMITED LICENSE The purchase of this product conveys to the purchaser the limited, non-transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser.	1239 KB	72

Newsletters (4)

Title	Size	Pages
POROS Chromatography E-Newsletter Dec 2012 Part #: CO24393 CaptureSelect® ligands provide alternative specificities and enable rapid binding for the quantitation or purification of biotherapeutic molecules such as IgG, IgM, IgA, Fab, HSA fusions, and IgG Fc fusions. Email bp@lifetech.com to find out which one works for you. For Research Use Only.	429 KB	1
Letter to HID Customers: Approaching Retirement of 3100 Genetic Analyzers (Oct 2011) Part #: 4336791 (1) For customers who have an existing AB Assurance contract purchased before September 6, 2011, Technical Support and FAS Support will continue to be available after December 31, 2011. APPROACHING RETIREMENT OF 3100 GENETIC ANALYZERS PLEASE PLAN AHEAD FOR MAXIMAL LAB PRODUCTIVITY	32 KB	2
3100 Retirement Timeline - September 2011 Part #: 4336791	984 KB	2
August 2011 SOLiD Read Newsletter Per lane sequencing has arrived Life Technologies proudly announces the arrival of 5500 Series Genetic Analysis Systems with pay-per-lane and application-per-lane sequencing for every researcher. The systems are shipping and being installed at sites now.	135 KB	1

Posters (2)

Title	Size	Pages	Hard Copy*
TargetSeq™ Exome and Custom Enrichment Kit product bulletin Part #: CO01309	518 KB	4
Scientific Poster: Expanding the Capabilities of Direct Amplification for Processing Databasing Samples Laboratories worldwide are developing or expanding forensic DNA databases and are looking for simple, robust, high throughput workflows to process their single source samples. Efficiently.	619 KB	1

Protocols (77)

Title	Size	Pages
Quick Reference: OpenArray Sample Tracker Software Part #: 4460657 Rev B ■ Product information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 ■ Supported instruments and plates . . . . . . . . . . . . . . . . . . . .	1533 KB	20
Quick Reference: RapidMAX Software Part #: 4469875 RevA ■ Log in and install assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1	252 KB	4
User Bulletin: 5500 Series Genetic Analysis Systems Mate-Paired Library Preparation: 10-kb gDNA inserts Part #: 4473503 Rev A ■ Check the size distribution of the library . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37 2 5500 Series Genetic Analysis Systems Mate-Paired Library Preparation: 10-kb gDNA inserts Preparation of Mate-Paired Libraries Containing 10-kb gDNA Inserts Preface	1927 KB	46
Insert: PrepFiler Automated Forensic DNA Extraction Kit Part #: 4463179 Rev B Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® and PrepFiler® BTA Automated Forensic DNA Extraction Kits User Guide (Part no. 4463349). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	192 KB	2
Insert: PrepFiler BTA Forensic DNA Extraction Kit Part #: 4463178 Rev B Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® and PrepFiler® BTA Forensic DNA Extraction Kits User Guide (Part no. 4463348). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	180 KB	2
Insert: PrepFiler Forensic DNA Extraction Kit Part #: 4463177 Rev B Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® and PrepFiler® BTA Forensic DNA Extraction Kits User Guide (Part no. 4463348). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	178 KB	2
Insert: PrepFiler Express BTA Forensic DNA Extraction Kit Part #: 4442396 Rev C Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® Express and PrepFiler® Express BTA Forensic DNA Extraction Kits User Guide (PN 4442699). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	215 KB	2
Insert: PrepFiler Express Forensic DNA Extraction Kit Part #: 4442395 Rev C Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® Express and PrepFiler® Express BTA Forensic DNA Extraction Kits User Guide (PN 4442699). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	210 KB	2
Quick Reference: PrepFiler and PrepFiler BTA Forensic DNA Extraction Kits Part #: 4468126 Rev B Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® and PrepFiler® BTA Forensic DNA Extraction Kits User Guide (Part no. 4463348). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	560 KB	8
Quick Reference: 5500 Series Genetic Analyzers: Reagents and Consumables Ordering Information Part #: 4465650 Rev. C Publication Part Number 4465650 Rev. C Revision Date December 2011 Use this guide to select the reagents and consumables required to perform a sequencing run on the 5500 Series Genetic Analyzers. • Select Sequencing Primer (SP) kit(s), as required by the library type and desired analysis tag.	674 KB	2
Quick Reference: CopyCaller™ Software Part #: 4400043 Rev C This CopyCaller® Software v2.0 Quick Reference Card contains abridged procedures for using CopyCaller® Software. For the complete procedures, theory of operation, or for safety and biohazard guidelines, refer to the CopyCaller® Software v2.0 User Guide (Part no. 4400042).	390 KB	4
User Guide: CopyCaller™ Software Part #: 4400042 Rev C Real-Time PCR System Applied Biosystems 7900HT Fast Real-Time PCR System Applied Biosystems 7300/7500/7500 Fast Real-Time PCR Systems Applied Biosystems StepOnePlus™ Real-Time PCR System Publication Part Number 4400042 Rev. C Revision Date November 2011 For Research Use Only.	2915 KB	92
User Guide: TargetSeq Exome Enrichment System Part #: MAN0004396 Rev 15 July 2011 For capturing the exons identified in the VEGA, CCDS, and RefSeq databases and >700 microRNA genes from human genomic DNA for sequencing on the SOLiD™ 4 System or 5500 SOLiD™ Series Systems Catalog Numbers A14060, A14061, A14062, and A14063	316 KB	1
Insert: TargetSeq Exome Enrichment System Part #: MAN0004567 Rev 7June 2011 Catalog no. (Probe Pool part no.) Size: A14060 (A14054) 4 reactions A14061 (A14055) 12 reactions A14062 (A14056) 48 reactions A14063 (A14057) 96 reactions Store at –20°C (non-frost-free) Visit www.invitrogen.com/manuals and search for the product catalog number for the complete user guide	224 KB	1
User Bulletin: GeneMapper ID-X Software Version 1.3; Verification Experiments and Installation Procedures Part #: 4470483 Rev A ■ Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 About GeneMapper® ID-X Software Version 1.3 . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 Purpose of this user bulletin . . . . . . . . . . . . . . . .	944 KB	24
User Guide: Power SYBR® Green PCR Master Mix and RT-PCR Reagents Kit Part #: 4367218 Rev E Publication Part Number 4367218 Rev. E Revision Date September 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	1096 KB	46
User Guide: SYBR® Green PCR Core Reagents Part #: 4304965 Rev F Publication Part Number 4304965 Rev. F Revision Date September 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	494 KB	42
Insert: SYBR Green PCR Master Mix Part #: 4309158 Rev G Note: For safety and biohazard guidelines, refer to the “Safety” section in the SYBR® Green PCR Master Mix and SYBR® Green RT-PCR Reagents Kit User Guide (PN 4310251). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	120 KB	2
Insert: Power SYBR Green PCR Master Mix Part #: 4367656 Rev C Note: For safety and biohazard guidelines, refer to the “Safety” section in the Power SYBR® Green PCR Master Mix and Power SYBR® Green RTPCR Reagents Kit User Guide (PN 4367218). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	146 KB	2
Single Cell Lysis Kit Product Insert Part #: 4458355 Rev D Note: For safety and biohazard guidelines, refer to the “Safety” section in the Single Cell-to-CT™ Kit User Guide (Part no. 4458356). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	133 KB	2
Single Cell-to-CT™ Kit Product Insert Part #: 4458354 Rev D Note: For safety and biohazard guidelines, refer to the “Safety” section in the Single Cell-to-CT™ Kit User Guide (Part no. 4458356). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	179 KB	2
PrepSEQ™ Sample Preparation Kits Part #: 4465875 Rev. A Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepSEQ® Sample Preparation Kits User Guide (Part No. 4465957). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	158 KB	8
Protocol for Mycoplasma Nucleic Acid Extraction Kits Part #: 4465957 Rev. A Publication Part Number 4465957 Rev. A Revision Date August 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	674 KB	35
Quick Reference Card for MycoSEQ™ Mycoplasma Detection Kits Part #: 4465876 Rev. A Note: For safety and biohazard guidelines, refer to the “Safety” section in the MycoSEQ™ Mycoplasma Detection Kits User Guide (PN 4465874). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. ■ Procedure . . . . .	158 KB	6
Protocol for MycoSEQ™ Mycoplasma Detection Kits Part #: 4465874 Rev. A Publication Part Number 4465874 Rev. A Revision Date August 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	1216 KB	41
Bovine Virus Diarrhea RNA Test Kit Instructions Part #: 4425603 Rev C The Bovine Virus Diarrhea RNA Test Kit (VetMAX™-Gold BVDV Detection Kit, PN 4413938) is intended for use in the rapid, in vitro detection of bovine virus diarrhea virus (BVDV) RNA extracted from ear punch samples obtained from acutely and persistently infected (PI) cattle.	624 KB	4
Quick Reference: PrepFiler® Automated Forensic DNA Extraction Kit Part #: 4468127 Rev A Note: For safety and biohazard guidelines, refer to the “Safety” section in the PrepFiler® Automated Forensic DNA Extraction Kit User Guide (Part no. 4463349). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	715 KB	6
resDNASEQ® Quantitative DNA Kits User Guide Part #: 4460662 Rev. B Stock #: 4460662B Publication Part Number 4460662 Rev. B Revision Date May 2011 For research use only. Not intended for any human or animal therapeutic or diagnostic use. Information in this document is subject to change without notice.	771 KB	32
Quick Reference: Ion Total RNA-Seq Kit for Small RNA Libraries Part #: 4467092 Rev C Note: For safety and biohazard guidelines, refer to the “Safety” section in the Ion Total RNA-Seq Kit User Guide (PN 4467098). For every chemical, read the Safety Data Sheet (SDS) and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	352 KB	8
Quick Reference: Ion Total RNA-Seq Kit for Whole Transcriptome Part #: 4467091 Rev C Note: For safety and biohazard guidelines, refer to the “Safety” section in the Ion Total RNA-Seq Kit User Guide (PN 4467098). For every chemical, read the Safety Data Sheet (SDS) and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves.	339 KB	6
Protocol: Ion Total RNA-Seq Kit Part #: 4467098 RevC Publication Part Number 4467098 Rev. C Revision Date October 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	2741 KB	70
resDNASEQ® Quantitative DNA Kits Quick Reference Guide Part #: 4468124 RevA Stock #: 4468124A Note: For safety and biohazard guidelines, refer to the “Safety” section in the resDNASEQ® Quantitative DNA Kits User Guide (Part no. 4460662). For every chemical, read the SDS and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. Product overview	280 KB	8
PrepSEQ® Residual DNA Sample Preparation User Guide Part #: 4460663Rev. B Stock #: 4460663B Publication Part Number 4460663 Rev. B Revision Date May 2011 For research use only. Not intended for any human or animal therapeutic or diagnostic use. Information in this document is subject to change without notice.	579 KB	26
Protocol: TaqMan Salmonella enterica Kit Protocol Part #: 4381939 Rev D Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document.	898 KB	38
Product Insert: BigDye Terminator v1.1 Matrix Standard (Dye Set E) Part #: 4363110 Rev C ©Copyright 2010. Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. Product Insert October 2010	141 KB	2
Silencer® Select, Ambion In Vivo, Custom Select siRNA, In Vivo Ready - Product Insert Part #: 4457172 Rev C Silencer® Select Pre-designed and Validated siRNA, In Vivo Ready Ambion® In Vivo Pre-designed and Custom Designed siRNA, In Vivo Ready or HPLC-purified Custom Select siRNA and Ambion® In Vivo Custom siRNA, In Vivo Ready	174 KB	2
Silencer® Select Pre-designed, Validated, and Custom Designed siRNA - Insert Part #: 4457171 Rev B Silencer® Select Pre-designed, Validated, and Custom Designed siRNA Custom Select siRNA Ambion® In Vivo Pre-designed, Custom Designed, and Custom siRNA, Standard Purity Note: For all reagents, read the Safety Data Sheet (SDS) and follow the handling instructions.	144 KB	2
Protocol: TaqMan® Fast Universal PCR Master Mix (2X) Part #: 4351891 Rev G Publication Part Number 4351891 Rev. G Revision Date August 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	628 KB	40
Product Insert: TaqMan® Fast Universal PCR Master Mix (2X), No AmpErase UNG Part #: 4357649 Rev D Note: For safety and biohazard guidelines, refer to the “Safety” section in the TaqMan® Fast Universal PCR Master Mix (2✕), No AmpErase® UNG (Part no. 4351891). For every chemical, read the Safety Data Sheets (SDSs) and follow the handling instructions.	139 KB	2
SOLiD™ Total RNA-Seq Kit Protocol Part #: 4452437 Rev B Publication Part Number 4452437 Rev. B Revision Date July 2011 For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice.	3952 KB	106
siPORT™ NeoFX™ Transfection Agent Part #: 4510M Rev D Product description siPORT™ NeoFX™ Transfection Agent is a lipid-based formulation that provides extremely high levels of transfection without inducing cellular stress that can lead to cytotoxicity. It can be used with a wide range of cell types† and under diverse growth conditions.	394 KB	12
Product Insert: VetMAX™ M. hyopneumoniae Controls Part #: 4425906 Rev C The VetMAX™ M. hyopneumoniae Controls is a mixture of Mycoplasma hyopneumoniae control DNA (1000 copies/µL) and Xeno™ DNA Control (1000 copies/µL) that serves as a positive control for amplification of M. hyopneumoniae DNA and Xeno DNA Control in multiplex real-time PCR.	97 KB	2
Product Insert: VetMAX™ M. hyopneumoniae Reagents - Applied Biosystems Design Part #: 4425905 Rev C The VetMAX™ M. hyopneumoniae Reagents is a proprietary primer and probe mix designed to amplify Mycoplasma hyopneumoniae DNA and Xeno™ DNA Control in multiplex realtime PCR. Use 1 µL of the VetMAX M. hyopneumoniae Reagents per 25-µL reaction. TaqMan® Probe Reporter/Quencher	104 KB	2
Product Insert: VetMAX M. hyopneumoniae Reagents Part #: 4425903 Rev C The VetMAX™ M. hyopneumoniae Reagents is a primer and probe mix designed to amplify Mycoplasma hyopneumoniae DNA and Xeno™ DNA Control in multiplex real-time PCR. The primer and probe designs for M. hyopneumoniae DNA amplification are published and publicly available. Use 1 µL of the VetMAX M.	99 KB	2
Product Insert: VetMAX T. foetus Controls Part #: 4425902 Rev C The VetMAX™ T. foetus Controls is a mixture of Tritrichomonas foetus control DNA (1000 copies/µL) and Xeno™ DNA Control (1000 copies/µL) that serves as a positive control for amplification of T. foetus DNA and Xeno DNA Control in multiplex real-time PCR. Use 8 µL of the VetMAX T.	97 KB	2
Insert: VetMAX T. foetus Reagents Part #: 4425901 Rev C The VetMAX™ T. foetus Reagents is a primer and probe mix designed to amplify Tritrichomonas foetus DNA and Xeno™ DNA Control in multiplex real-time PCR. The primer and probe designs for T. foetus DNA amplification are published and publicly available. Use 1 µL of the VetMAX T.	100 KB	2
VetMAX BTV Reagents PI Sheet Part #: 4425898 Rev C The VetMAX™ Bluetongue Virus Reagents is a primer and probe mix designed to amplify bluetongue virus (BTV) RNA and Xeno™ RNA Control in multiplex real-time RT-PCR. The primer and probe designs for BTV RNA amplification are published and publicly available.	97 KB	2
VetMAX BRSV Controls PI Sheet Part #: 4425884 Rev C The VetMAX™ BRSV Controls is a mixture of bovine respiratory syncytial virus (BRSV) control RNA (1000 copies/µL) and Xeno™ RNA Control (1000 copies/µL) that serves as a positive control for amplification of BRSV RNA and Xeno RNA Control in multiplex real-time RT-PCR.	94 KB	2
VetMAX BRSV Reagents PI Sheet Part #: 4425879 Rev C The VetMAX™ BRSV Reagents is a primer and probe mix designed to amplify bovine respiratory syncytial virus (BRSV) RNA and Xeno™ RNA Control in multiplex real-time RT-PCR. The primer and probe designs for BRSV RNA amplification are published and publicly available.	51 KB	2
VetMAX IBR Controls PI Sheet Part #: 4425882 Rev C The VetMAX™ IBR/BHV-1 Controls is a mixture of bovine herpesvirus 1 (BHV-1) control DNA (1000 copies/µL) and Xeno™ DNA Control (1000 copies/µL) that serves as a positive control for amplification of BHV-1 DNA and Xeno DNA Control in multiplex real-time PCR.	95 KB	2
VetMAX IBR Reagents PI Sheet Part #: 4425817C The VetMAX™ IBR/BHV-1 Reagents is a primer and probe mix designed to amplify bovine herpesvirus 1 (BHV-1) DNA and Xeno™ DNA Control in multiplex real-time PCR. The primer and probe designs for BHV-1 DNA amplification are published and publicly available.	100 KB	2
Protocol: TaqMan® Fast Virus 1-Step Master Mix Part #: 4453800 Rev B Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.	1774 KB	42
User Bulletin: ViiA 7 Real-Time PCR System Part #: 4467664 Rev A Overview New 96-well block users currently using ViiA™ 7 Software v1.0 are required to upgrade to ViiA™ 7 Software v1.1 in order to calibrate their new 96-well block. In this user bulletin This user bulletin covers: ■ Purpose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .	171 KB	2
SOLiD 5500 Protocol for Tecan EVO75 Updated Freedom EVO and Freedom EVOware are registered trademark of Tecan Group Ltd. AMPure is a registered trademark of Beckman Coulter, Inc. Covaris is a registered trademark of Covaris, Inc. TaqMan is a registered trademark of Roche Molecular Systems, Inc.	1554 KB	44
SOLiD4 Protocol for Tecan EVO75 Updated Freedom EVO and Freedom EVOware are registered trademark of Tecan Group Ltd. AMPure is a registered trademark of Beckman Coulter, Inc. Covaris is a registered trademark of Covaris, Inc. TaqMan is a registered trademark of Roche Molecular Systems, Inc.	1822 KB	44
SOLiD4 Exd file for Tecan EVO150 Transfer_Rack("28","22",1,0,1,0,0,"","Eppendorf 96/500 DNA LoBind","Narrow","","","AB MP 3Pos","","Te-Shake 1Pos 2 MP SOLiD","2","(Not defined)","2"); WaitTimer("4","420"); GroupEnd(); Group("Size Selection 2"); Variable(SAMPLE_CNT,"SAMPLE_CNT",0,"",0,1.000000,24.000000,0,2,0,0);	55 KB	1
SOLiD4 Adaptor Calculator for Tecan EVO150 Tecan EVO Applied Biosystems® SOLiD™ 4 System Adaptor Calculator Tool Instructions: Fill in library information in white cells. Calculated values will automatically appear in yellow cells. Platform: SOLiD™ 4 Standard Standard Final PCR Reaction Volume Protocol: Express Barcoded Sample	69 KB	1
SOLiD4 Frag Protocol for Tecan EVO150 Freedom EVO and Freedom EVOware are registered trademark of Tecan Group Ltd. AMPure is a registered trademark of Beckman Coulter, Inc. Covaris is a registered trademark of Covaris, Inc. TaqMan is a registered trademark of Roche Molecular Systems, Inc.	1091 KB	42
SOLiD 5500 Frag EXD for Tecan Evo150 Transfer_Rack("28","22",1,0,1,0,0,"","Eppendorf 96/500 DNA LoBind","Narrow","","","AB MP 3Pos","","Te-Shake 1Pos 2 MP SOLiD","2","(Not defined)","2"); WaitTimer("4","420"); GroupEnd(); Group("Size Selection 2"); Variable(SAMPLE_CNT,"SAMPLE_CNT",0,"",0,1.000000,24.000000,0,2,0,0);	56 KB	1
SOLiD 5500 Frag for Tecan EVO 150 Freedom EVO and Freedom EVOware are registered trademark of Tecan Group Ltd. AMPure is a registered trademark of Beckman Coulter, Inc. Covaris is a registered trademark of Covaris, Inc. TaqMan is a registered trademark of Roche Molecular Systems, Inc.	1036 KB	42
Product Insert: AmpFlSTR® Identifiler® Direct PCR Amplification Kit (200 reactions) Part #: 4468050 Rev A IMPORTANT! Reagents used for amplification must be isolated from any source of contaminating DNA, especially from previously amplified AmpFlSTR® PCR products and the AmpFlSTR® Allelic Ladders. Thaw reagents completely before first use.	186 KB	2
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Swedish Translation Part #: 4461395 Rev B För riktlinjer om säkerhet och biologiska risker, se avsnittet "Safety" i TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429). För varningar och försiktighetsåtgärder, se bipacksedeln TrueScience™ RespiFinder® Identification Panels Product Insert (PN 4460486).	517 KB	6
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Turkish Translation Part #: 4461394 Rev B Güvenlik ve biyolojik tehlike yönergeleri için TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429) “Safety” kısmına bakın. Uyarılar ve önlemler için, TrueScience™ RespiFinder® Identification Panels Product Insert'e (PN 4460486) başvurun.	517 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Spanish Translation Part #: 4461393 Rev B Si desea conocer las recomendaciones de seguridad y riesgos biológicos, consulte el apartado “Safety” en el documento TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429).	519 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Russian Translation Part #: 4461379 Rev B Указания по безопасности и биологической опасности приведены в разделе «Safety» в TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429).	539 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Portuguese Translation Part #: 4461378 Rev B Identification Panels Product Insert (PN 4460486). Para cada produto químico, leia as fichas de dados de segurança (SDS) e siga as instruções de manipulação. Use óculos, vestuário e luvas de protecção adequados.	519 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Polish Translation Part #: 4461377 Rev B RespiFinder® Identification Panels Protocol (PN 4460429). Informacje dotyczące ostrzeżeń i środków ostrożności można znaleźć w dokumencie TrueScience™ RespiFinder® Identification Panels Product Insert (PN 4460486).	520 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Korean Translation Part #: 4461376 Rev B 안전 및 생물학적 유해 물질 관련 수칙은 TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429) 의 "Safety" 섹션 을 참조하십시오 .	619 KB	6
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Japanese Translation Part #: 4461375 Rev B appliedbiosystems.com/respifinderlit をご参照ください。 TrueScience™ RespiFinder® Identification Panels ユーザーガイドをダウンロードするには、www.appliedbiosystems.	592 KB	6
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Greek Translation Part #: 4461374 Rev B Για κάθε χημική ουσία, διαβάστε το φύλλο δεδομένων ασφαλείας (SDS) και ακολουθήστε τις διαδικασίες χειρισμού.	538 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - German Translation Part #: 4461373 Rev B Die Richtlinien zur Sicherheit und Biogefährdung finden Sie im Abschnitt „Safety“ im TrueScience™ RespiFinder® Identification Panels Protocol (PN 4460429). Warnungen und Sicherheitsmaßnahmen finden Sie im TrueScience™ RespiFinder® Identification Panels Product Insert (PN 4460486).	525 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - French Translation Part #: 4461372 Rev B Identification Panels Product Insert (PN 4460486). Concernant tous les produits chimiques, lire la fiche signalétique et suivre les consignes de manipulation. Porter des protections oculaires, des gants et des vêtements appropriés.	524 KB	8
TrueScience™ RespiFinder® Identification Panels Quick Reference Card - Arabic Translation Part #: 4461370 Rev B TrueScience™ RespiFinder® Identification Panels Headquarters 5791 Van Allen Way \| Carlsbad, CA 92008 USA Phone 760.603.7200 www.lifetechnologies.com Translated from the English PN 4460430 Rev. A Part Number 4461370 Rev. B 07/2011	3580 KB	6
Quick Reference Card: Applied Biosystems® TrueScience™ Aneuploidy STR Kits Part #: 4457193C Note: For safety and biohazard guidelines, refer to the “Safety” section in the Applied Biosystems® TrueScience™ Aneuploidy STR Kits Protocol (PN 4454039). For warnings and precautions, refer to the Applied Biosystems® TrueScience™ Aneuploidy STR Kits Product Insert (PN 4453329).	277 KB	3
Protocol: Applied Biosystems® TrueScience™ Aneuploidy STR Kits Part #: 4454039 Rev C Publication Part Number 4454039 Rev. C Revision Date July 2011 The results obtained from these or any other diagnostic kits should be used and interpreted only in the context of the overall clinical picture. Life Technologies cannot accept responsibility for any clinical decisions that are made.	2987 KB	75
Product Insert: Applied Biosystems® TrueScience™ Aneuploidy STR Kits Part #: 4453329 Rev D To obtain documents, go to www.appliedbiosystems.com/ aneuploidy, then click the link for [Support], or contact your local Life Technologies representative. For safety and biohazard guidelines, refer to the “Safety” section in the TrueScience™ Aneuploidy STR Kits Protocol (PN 4454039).	585 KB	2

References (8)

Title	Size	Pages
Assay Index File v18 for miRNA (excel) bfl-miR-96::bta-miR-96::cfa-miR-96::dre-miR-96::eca-miR-96::fru-miR-96::hsa-miR-96-5p::mdo-miR-96::mmu-miR-96-5p::oan-miR-96::ppy-miR-96::rno-miR-96::tni-miR-96::xtr-miR-96	3685 KB	1
Assay Index File v18 for miRNA (txt) 2)::rno-miR-290(15) CUCAAACUAUGGGGGCACUUUUU INV 000189 mmu-miR-295 mmu-miR-295-3p MIMAT0000373 mmu-miR-295(17) AAAGUGCUACUACUUUUGAGUCU INV 000190 mmu-miR-298 mmu-miR-298(9.2)::rno-miR-298(9.	1516 KB	1
Custom TaqMan® Array Card Formats: Miscellaneous Stock #: 127MI57-03 Format 12 (Part no. 4342247) 11 unique assays 1 mandatory control 8 unique samples Format 24 (Part no. 4342249) 23 unique assays 1 mandatory control 8 unique samples Format 16 (Part no. 4346798) 15 unique assays 1 mandatory control 8 unique samples Format 32 (Part no. 4346799) 31 unique	324 KB	2
GeneMapper® ID-X Software Hotfix_20110620 Release Notes ID-X Software Hotfix_20110620 (“Hotfix_20110620”) * System Requirements * Before Installation of Hotfix_20110620; Special Considerations * Installation of Hotfix_20110620 for GeneMapper® ID-X Software v1.0.1 * Installation of Hotfix_20110620 for GeneMapper® ID-X Software v1.	506 KB	8
AmpFlSTR® NGM™ PCR Amplification Kit - Overview − Improved buffer formulation overcomes significant levels of inhibition and supports enhanced profile and locus balance, even when inhibitors are present − Concentration of loci in the low molecular weight region of the profile increases the power of discrimination in partial profiles	1095 KB	39
Product Information Sheet: Attune™ performance tracking beads Format,1,2,,,,,,,,,,,,,, Culture,en-US,,,,,,,,,,,,,,, Lot Number,756080,,,,,,,,,,,,,,, Product Name,4 Peak Beads,,,,,,,,,,,,,,, Expiration Date,5/20/2021,,,,,,,,,,,,,,, FSC bead ratio,0.	0 KB	1
Centrifuge Compatibility Chart Stock #: CO11312 Centrifuge compatibility Previous-generation centrifuges Current vendor Centrifuge Centrifuge rotor Applied Biosystems bucket for TaqMan® Array Sorvall Legend T Plus, 120 V Thermo-Fisher 75004367 75006445 (includes required tool) or 75006434 (twist-on) 4337762 Sorvall Legend T Plus, 230 V	99 KB	1
SOLiD 5500 Adaptor Calculator for Tecan Evo150 Fill in library information in white cells. Calculated values will automatically appear in yellow cells. A 1:10 dilution is required for values in red. Platform: SOLiD™ 5500 Standard Standard Final PCR Reaction Volume Protocol: Express Barcoded Sample DNA Position	73 KB	1

The lock icon

indicates a document that requires registration for download.
* Hard Copy require registration for document delivery.

Reset Deliver Selected Documents

Applied Biosystems ™ – by Life Technologies™

What’s New:

Assay Searches:

Applications:

Technologies:

Documents:

Downloads:

Technical Resources:

Product & Technical Literature

Your search for "" in "All Categories" returned 199 results.

Help

Shop

Guides & Tools

Life Technologies

Follow Us:

Applied Biosystems ™ – by Life Technologies™

What’s New:

Assay Searches:

Applications:

Technologies:

Documents:

Downloads:

Technical Resources:

Product & Technical Literature

Your search for "" in "All Categories" returned 199 results.

Help

Shop

Guides & Tools

Life Technologies

Follow Us:

Select Your Country