Select Your Country
To ensure that you see the most relevant information, please select your country.
Country:
Submit
Support
Contact Support FAQs Tools Tutorials & Troubleshooting Software Downloads, Patches & Updates Software Community Program

Product & Technical Literature

Select a tab below to find and order the documents you need.  To view a PDF, please download the newest version of Adobe® Reader.


View By:  

Your search for "" in "All Categories" returned 131 results.

Search Again
Application Notes & Tutorials (10)     Articles & White Papers (3)      Brochures & Specifications (20)      Case Studies (7)      Instrument Setup & Maintenance (1)      Manuals (11)      Newsletters (1)      Posters (9)      Protocols (9)      References (1)      Additional Documents (10)     
The lock icon Requires Registration indicates a document that requires registration for download.
* E-mail and/or Hard Copy require registration for document delivery.
ResetDeliver Selected Documents

Application Notes & Tutorials (10)

Title Size Pages E-mail* Hard Copy*
GeneMapper® Software v4.1 Product Bulletin
Stock #: 106PB18-01

• Save time in the analysis pipeline with the co-installation and autoanalysis features of Data Collection v1.0 Software* on 3500 Series Genetic Analyzers, and Data Collection v3.1 Software† on 3130 and 3730 Genetic Analyzer platforms
942 KB 4  
MitoMap
Stock #: MitoMap
178 KB 1
MitoCR
Stock #: MitoCR_design info

CR MitoCR RSS000056016V01 complete 9 RSA001145133 578 TGTAAAACGACGGCCAGTCTAGGAGGCGTCCTTGCCCT CAGGAAACAGCTATGACCGGGTTTGATGTGGGTTGGGTT H2 34 MT 16658 17236 -70 508 CR MitoCR RSS000056016V01 complete 9 RSA001250252 589 TGTAAAACGACGGCCAGTGAAAAAGTCTTTAACTCCACCATTAGCACC
7 KB 1
MitoAll
Stock #: MitoAll_entire_set

All MitoAll RSS000056015V01 complete 46 RSA001145148 369 TGTAAAACGACGGCCAGTCCCGTTCCAGTGAGTTCACCC CAGGAAACAGCTATGACCCCCAGTTTGGGTCTTAGCTATTGTGTG H2 34 MT 1757 2126 129 498 All MitoAll RSS000056015V01 complete 46 RSA001145163 559 TGTAAAACGACGGCCAGTGGTTGGTCAATTTCGTGCCAG
11 KB 1
GeneMapper Software v4.1 Product Bulletin
Stock #: 106PB18-01

• Save time in the analysis pipeline with the co-installation and autoanalysis features of Data Collection v1.0 Software* on 3500 Series Genetic Analyzers, and Data Collection v3.1 Software† on 3130 and 3730 Genetic Analyzer platforms
942 KB 4  
Inter-Simple Sequence Repeat Genotyping of Endangered Plants
Stock #: 106AP31-01

Inter-simple sequence repeat (ISSR) PCR is a fast and inexpensive genotyping technique with a wide range of uses, including the characterization of genetic relatedness among populations.
3318 KB 6  
Bioinformatic Evaluation of a Sequence for Custom TaqMan® SNP Genotyping Assays: Guide: Rev B
Part #: 4371003    Stock #: 135GU01-02

SNP Genotyping Service) are custom assays that are designed, synthesized, formulated, and delivered as analytically quality-controlled primer and probe sets for single nucleotide polymorphism (SNP) genotyping assays based on sequence information submitted by the customer.
508 KB 17  
The Power of LC MALDI: Identification of Proteins by LC MALDI MS/MS Using the Applied Biosystems 4700 Proteomics Analyzer wit
Stock #: 115AP18-01

The Applied Biosystems 4700 Proteomics Analyzer with GPS Explorer™ Software enables a fully automated and advanced LC MALDI MS/MS workflow for protein identification from complex mixtures.
279 KB 6
Detection of Large Deletions or Duplications in Genomic DNA Using Quantitative Multiplex PCR-Based Assay on Applied Biosystem
Stock #: 106AP23-01
5070 KB 6
CYP450 Protein Assay - Human Induction Kit
Part #: 114AP111    Stock #: 01

There are currently three main methodologies for assessing CYP450 induction: mRNA measurements, enzymatic activity measurements, and Western blot analysis. Although all three are widely used throughout the pharmaceutical industry, there are drawbacks to each.
581 KB 5    


Articles & White Papers (3)

Title Size Pages E-mail* Hard Copy*
Quantitate Stem Cell Pluripotency Proteins Using TaqMan® Real-Time PCR Assays
Stock #: 127AR16-01

Protein Expression Assays are designed for fast, easy identification and relative quantitation of proteins from small sample sizes or limited numbers of cells.
246 KB 2    
Identifying Protein Biomarkers for Testicular Cancer Research Using Proximity Ligation Assays
Stock #: 127AR15-01

Protein Expression Assays, an adaptation of proximity ligation assay (PLA™) technology, to quantify protein biomarkers for pluripotency using small quantities of human stem cell and testicular germ cell samples. Such biomarkers can potentially be used to identify and characterize malignant cells.
382 KB 2    
EXPANDING THE BIOANALYTICAL TOOLKIT: INCREASED SENSITIVITY FOR DRUG QUANTITATION UTILIZING THE SCIEX API 5000™ LC-MS/MS SYS
Stock #: 114AR11-01

Photo courtesy of Applied Biosystems. Reproduction or duplication of these photos is strictly forbidden without the express written permission of Applied Biosystems.
892 KB 6    


Brochures & Specifications (20)

Title Size Pages E-mail* Hard Copy*
Fast SYBR® Green Master Mix
Stock #: 136PB11-02

Green Master Mix delivers highly sensitive and reproducible real-time PCR results in less than half the time when used with Applied Biosystems® fastenabled, real-time PCR instruments. The Fast master mix also offers high specificity by employing a new highly purified AmpliTaq®
2130 KB 4
ViralSEQ™ Vesivirus Detection Assay
Part #: 128DA01-01    Stock #: 128DA01-01

Viral contamination in mammalian product manufacturing presents a serious risk to the manufacturing process, the manufacturing facility, and the integrity of the product. Vesivirus 2117 is an RNA virus that has reemerged as a potential threat to mammalian cell culture production.
1139 KB 2    
AmpFlSTR(R) Identifiler(R) Plus PCR Amplification Kit Validation Certificate

Plus PCR Amplification Kit. These experiments were performed according to the DNA Advisory Board (DAB) Quality Assurance Standards (October 1,1998) and guidelines from the Scientific Working Group on DNA Analysis Methods (SWGDAM, July 10, 2003).
146 KB 1    
TaqMan® Gene Expression Master Mix and TaqMan® RNA-to-CT™ 2-Step Kit
Stock #: 136PB01-04

Tailored for quantitative, real-time PCR experiments. Unrivaled sensitivity for both routine and challenging applications, rare transcript detection, duplex PCR, and specific detection of homologous sequences. • Gene expression analysis
1351 KB 6    
Custom TaqMan Small RNA Assays (Early Access)
Stock #: 127PB18-01

As research on the effects of small RNAs, both naturally occurring and synthetic, accumulates, so does the need to detect and quantitate these important effectors of gene expression. With over 30 publications to date, Applied Biosystems pioneered the use of TaqMan®
578 KB 2
Intelligent MS/MS Acquisition Combined with Better Database Searching Tools Increase Coverage of Complex Protein Mixtures
Stock #: 114TN09-01

Analysis of complex proteomic samples is increasingly important in the areas of biomarker discovery and protein identification. As the complexity of the sample increases, data quality and speed of data acquisition become more of a factor.
207 KB 4  
Smart Monitoring Service: Leveraging the power of the Internet while maintaining system security: Product Bulletin
Stock #: 121PB07-03

Applied Biosystems Smart Monitoring Service, using a suite of software products, allows remote devices to exchange instrument diagnostic information with people and enterprise business systems.
128 KB 4
Assay Index File v8 for miRNA (txt)

TAQMAN®MICRORNAASSAYS TaqMan® MicroRNA Assays "miRBase v14, 09/15/2009" "AIF v13, 11/04/2009" "Note: For controls, the miRBase names, accessions, and aliases come from NCBI.
311 KB 1    
Assay Index File v8 for miRNA (excel)

bfl-miR-96::bta-miR-96::cfa-miR-96::dre-miR-96::eca-miR-96::fru-miR-96::hsa-miR-96::mdo-miR-96::mmu-miR-96::oan-miR-96::rno-miR-96::tni-miR-96::xtr-miR-96
574 KB 1    
Evaluation of MS3 vs. MRM for the Measurement of Tacrolimus on a Hybrid Triple Quadrupole / Linear Ion Trap Mass Spectrometer
Stock #: 114TN04-01

Tacrolimus is a critical dose immunosuppressant drug that requires intensive concentration monitoring and subsequent dose individualization for solid organ transplant recipients.
524 KB 5  
Definitive Protein Identification from Complex Mixtures with the 4800 MALDI TOF/TOF™ Analyzer: Novel LC/MALDI Application U

Sample sets for proteomic studies are usually very limited in sample amounts, yet at the same time extremely complex with respect to the number of proteins present in a given sample.
651 KB 4  
The New QSTAR® Elite System for Improved Metabolite Identification: Technical Note

The goal of metabolite profiling is to find all of the major and minor metabolites for a given drug candidate. This can be very challenging, and the instrument chosen to accomplish this task is critical. The new QSTAR®
462 KB 7  
The QSTAR® Elite and System and Dynamic AutoCalibration: The Ease of Maintaining Mass Accuracy during Sample Analysis

Two types of calibrations can be performed; internal and external. Mass accuracy specifications usually have ppm values associated with each type of calibration and usually mention the length of time before another calibration needs to be done to maintain the desired mass accuracy.
414 KB 6  
The QSTAR® Elite and Mass Defect Triggered IDA (MDt™ IDA): Improved Ion Selection for Metabolism Studies: Technical Note

The difference between the exact mass and the nominal (nearest integer) mass of a compound is known as the mass defect. In metabolism studies, closely related molecules like the parent drug and its metabolites should have very similar mass defects.
389 KB 5  
The QSTAR® Elite System and Automated Experiments: Real-Time Dynamic Background Subtraction (DBS) for Improved Ion Selection

Information Dependent Acquisition (IDA) is a software tool that helps select the best ion(s) to target for MS/MS data acquisition during an LC analysis. Its main purpose is to collect as much information as possible on real ions from every injection.
397 KB 5  
The QSTAR® Elite and Mass Defect Triggered IDA (MDt™ IDA): Improved Ion Selection for Metabolism Studies: Technical Note

The difference between the exact mass and the nominal (nearest integer) mass of a compound is known as the mass defect. In metabolism studies, closely related molecules like the parent drug and its metabolites should have very similar mass defects.
389 KB 5  
NanoSpray® II Source and Heated Interface for QSTAR® XL and QSTAR® Elite Systems: Technical Note
Stock #: 114TN08-01

Elite systems. Ions are generated within a few millimeters of the entrance to the heated laminar flow chamber. Two stages of desolvation are provided with the Curtain Gas TM interface and heated chamber.
186 KB 3  
The QSTAR® Elite System and Dynamic AutoCalibration: The Ease of Maintaining Mass Accuracy during Sample Analysis

Two types of calibrations can be performed; internal and external. Mass accuracy specifications usually have ppm values associated with each type of calibration and usually mention the length of time before another calibration needs to be done to maintain the desired mass accuracy.
414 KB 6  
The New QSTAR® Elite System for Improved Metabolite Identification: Technical Note

The goal of metabolite profiling is to find all of the major and minor metabolites for a given drug candidate. This can be very challenging, and the instrument chosen to accomplish this task is critical. The new QSTAR®
462 KB 7  
TargetSeq™ Resequencing System for Applied Biosystems 3730 and 3730xl DNA Analyzers: Product Bulletin
Stock #: 106PB14-01

A growing number of sequencing laboratories are expanding beyond de novo sequencing projects to more resequencing and medical sequencing of small exons and short DNA fragments. The TargetSeq™
374 KB 2  


Case Studies (7)

Title Size Pages E-mail* Hard Copy*
Gene Hunters Find Cause of Childhood Polycystic Kidney Disease
Stock #: 1002-02

For children with autosomal recessive polycystic kidney disease (ARPKD), the future is anything but certain. Although rare, it is often lethal and difficult to diagnose. The disease causes cysts in the kidney, chronic liver fibrosis, and poor lung development.
225 KB 2  
California Missing Persons DNA Program Challenged with Identifying Thousands of Human Remains
Stock #: 1006-02

Each year in California the identity of approximately 100 deceased people cannot be made. Currently the state has records of 2,100 such remains, some dating as far back as 1959. It is the task of John Tonkyn, Ph.D.
285 KB 2  
Drug Discovery Accelerates as Metabolite Analysis Improves
Stock #: 1003-02

These analyses measure organism-drug interaction, including the degree of metabolic uptake, activity in the body before breakdown, production of toxic metabolites, and excretion or storage of the drug and its products.
272 KB 2  
Assays-by-Design Service Helps HuBit Genomix Create Pharmacogenomics Information Products
Stock #: 1005-02

Census numbers indicate that one-quarter of the Japanese population will be over the age of 65 by 2020. As Dr. Masaaki Muramatsu, Director of Research at HuBit Genomix, states, as the average age of the Japanese population continues to climb, so too do the demand for and cost of healthcare.
207 KB 2  
Assays-on-Demand™ Gene Expression Products Accelerate Cancer Research at UCSF
Stock #: 1001-02

Dr. David Ginzinger’s genome analysis core facility helps University of California, San Francisco (UCSF) researchers investigate aspects of the genome most likely implicated in disease.
226 KB 2  
New High-Throughput DNA Analyzers Applauded with Increase in Large-Scale DNA Sequencing Projects
Stock #: 1004-02

Elaine Mardis, Ph.D., director of technology development and co-director of the Genome Sequencing Center (GSC) at the Washington University School of Medicine in St. Louis, has a lot of successful large-scale DNA sequencing experience.
267 KB 2  
SQL*LIMS Software Streamlines Product Release at Baxter BioScience
Stock #: 1000-02

Baxter BioScience produces and develops plasma-based and recombinant therapeutic proteins for hemophilia, immune deficiencies, and other blood-related disorders, including coagulation factors, immunoglobulins, albumin, woundmanagement products, and vaccines.
213 KB 2  


Instrument Setup & Maintenance (1)

Title Size Pages E-mail* Hard Copy*
SDS 2 4 Upgrade and Installation Instructions
Part #: na   

IMPORTANT! The performance of SDS 2.4 software has only been tested for operating compatibility with Dell Optiplex 745 Standard, Optiplex 755 Standard and Optiplex 960 Plus computers running Windows XP® Service Pack 3 operating system. If a user needs to upgrade their computer from Windows NT 4.
131 KB 5    


Manuals (11)

Title Size Pages E-mail* Hard Copy*
TaqMan® Drug Metabolizing Genotyping Assay Index File (.txt)

3 Human 5q31.1,5q31,5q3,5q31.1b,5q 5 0 0 0 0 Homo sapiens C__27861809_10 CYP2C19 CPCJ|CYP2C|P450C2C|P450IIC19|RP11-400G3.4 CYP2C19*3,c.636G>A|CYP2C19*3A,c.636G>A|CYP2C19*3A,g.17948G>A|CYP2C19*3B,c.636G>A|CYP2C19*3B,g.17948G>A|CYP2C19,c.
947 KB 1  
TaqMan® Drug Metabolizing Genotyping Assay Index File (.xls)

3 Human 5q31.1,5q31,5q3,5q31.1b,5q 5 0 0 0 0 Homo sapiens C__27861809_10 CYP2C19 CPCJ|CYP2C|P450C2C|P450IIC19|RP11-400G3.4 CYP2C19*3,c.636G>A|CYP2C19*3A,c.636G>A|CYP2C19*3A,g.17948G>A|CYP2C19*3B,c.636G>A|CYP2C19*3B,g.17948G>A|CYP2C19,c.
947 KB 1  
Network Port Calibration and StepOne™ Instrument Connection Procedures
Part #: 4391120 Rev A    Stock #: 117UB29-01

If your computer does not connect to the StepOne™ instrument, you must check that the network port on the computer is set to DHCP (to automatically obtain the IP address). To check the status of your computer network port: 1.
1084 KB 8  
Performing Genotyping Using the SNPlex™ Genotyping System 48-Plex: Applied Biosystems 3130xl Genetic Analyzer: User Bulleti
Part #: 4362239    Stock #: 130UB01-04

Assembling Required Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Setting Up the 3130xl Genetic Analyzer for SNPlex™ System Experiments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Planning SNPlex™ System Experiments for the 3130xl Genetic Analyzer . . . . .
787 KB 16  
Applied Biosystems StepOne™ and StepOnePlus™ Real-Time PCR Systems
Part #: 4376785 Rev E   

Getting Started Guide © Copyright 2008, Applied Biosystems. All rights reserved. Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document.
15739 KB 320  
Applied Biosystems StepOne™ and StepOnePlus™ Real-time PCR Systems
Part #: 4376784 Rev E   

Getting Started Guide © Copyright 2008, Applied Biosystems. All rights reserved. Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document.
8800 KB 174  
Introducing New 96-Well Fast Plate Adapters for Applied Biosystems Capillary Electrophoresis Systems: ABI PRISM® 310, 3100 &
Part #: 4370890    Stock #: 106UB48-03

ABI PRISM® 310, 3100 & 3100-Avant Genetic Analyzers, Applied Biosystems 3130 & 3130xl Genetic Analyzers, and Applied Biosystems 3730 & 3730xl DNA Analyzers August 2006 SUBJECT: Introducing New 96-Well Fast Plate Adapters for Applied Biosystems Capillary Electrophoresis Systems
1140 KB 12  
Decontaminating the ABI PRISM 6100 Nucleic Acid PrepStation and Updating Safety and CE Compliance Information: ABI PRISM 6100
Part #: 4371397    Stock #: 134UB01-01

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Decontaminating the 6100 Nucleic Acid PrepStation. . . . . . . . . . . .
85 KB 4  
Applied Biosystems MicroSeq® ID Analysis Software Version 2.0: Getting Started Guide: Rev B
Part #: 4364623   

© Copyright 2006, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document.
3937 KB 158  
Autoanalysis: GeneMapper® Software Version 4.0: User Bulletin: Rev A
Part #: 4367795    Stock #: 133UB06-01

Software v4.0 . . . . . . . . . . . . . . 2 Autoanalysis Setup and Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Setting Up the GeneMapper® Software . . . . . . . . . . . . . . . . . . . . . . 6 Setting Up a Shared Folder (Remote Autoanalysis Only). . . . . . . . .
993 KB 36  
TargetSeq™ Resequencing System: Applied Biosystems 3730/3730xl DNA Analyzer: User Bulletin: Rev C
Part #: 4370498    Stock #: 133UB07-03

Resequencing System now available from Applied Biosystems is a 3730-series software system designed for high-throughput resequencing or medical research sequencing of small exons and other small targeted regions.
519 KB 8  


Newsletters (1)

Title Size Pages E-mail* Hard Copy*
Procise Protein Sequencer

I wish to inform you of the approaching discontinuance of the Procise Protein Sequencing instrument of all cartridge configurations effective June 30th , 2008.
20 KB 1    


Posters (9)

Title Size Pages E-mail* Hard Copy*
Haplotype Tagging SNPs Selected in One Human Population are Highly Informative in Additional Populations
Stock #: 132PR05-01

To confirm disease associations, it is desirable to know whether a set of haplotype tagging SNPs (tSNPs) selected in one population will be informative in other populations. Tagging SNPs were selected separately for each of 4 human populations genotyped on about 20,000 SNPs on 3 chromosomes.
308 KB 1  
Patterns of Linkage Disequilibrium Between SNPs on a Sardinian Population Isolate and the Selection of Markers for Fine-mappi
Stock #: 132PR04-01
1153 KB 1  
Transfer of Existing Forensic LC/MS and LC/MS/MS Mass Spectral Libraries to Linear Ion Trap Instrumentation: Poster Number TH
Stock #: 114PR04-01

Mass spectral libraries are necessary for the General Unknown Screening in e.g. forensic or environmental analysis. Several libraries were developed and successfully applied by different working groups.
1016 KB 4  
Simultaneous Qualitative and Quantitative LC/MS/MS Analysis of Opiates in Biological Matrices: Poster Number TH-134
Stock #: 114PR03-01

Data acquired from the MRM mode was used to quantitate the drugs and their corresponding internal standards that were spiked into urine and saliva. The presence of the drug in the matrix triggered the generation of a product ion scan spectra in the trap mode.
427 KB 4  
Comparison of 3 ionization modes for Quantification of Cannabinoids in Biological Samples: Poster No. 042
Stock #: 114PR02-01

Annie CAILLEUX1, Bertrand DIQUET1, Bénédicte DURETZ2, Joaquim SOARES-GRANJA2, 1Centre hospitalo universitaire, Angers, France; 2Applied Biosystems, Courtaboeuf, France. CONCLUSIONS An LC/MS-MS research method has been developed for cannabinoids analysis.
662 KB 1  
Simultaneous Screen of 23 Drugs of Abuse by LC-API-MS/MS: Research Report: Scientific Poster Reprint
Stock #: 114PR01-01

Research laboratories that engage in the screening of patient samples for drugs of abuse currently employ immuno- or colorimetric assays. These assays suffer from lack of sensitivity and can be relatively costly due to the high volume of reagents used.
71 KB 1  
Identification of In-Vitro Metabolites of Indinavir, Using a Hybrid Triple Quadrupole / Linear Ion Trap Q TRAP™ Mass Spectr

In such cases, full scan MS should be better or possibly the only choice for IDA survey scans. Hence, for metabolites elucidation, it is a high desire to have high sensitivity Q3 and product ion scans.
198 KB 4    
Improvements in the Design of Multiplexed Oligonucleotide Ligation Assays forHigh Throughput SNP Genotyping
Stock #: 132PR03-01

Genome-wide association studies involving thousands of DNA samples in combination with many SNP loci require hundreds of thousands of genotypes per project.
1236 KB 1  
SNPlex™ System Human Linkage Mapping Set 4k: A 1.1cM resolution cluster-based SNP linkage mapping set based on genetic dist
Stock #: 132PR02-01

Janet Ziegle, Fiona Hyland, Joseph Day, Ryan Koehler, Nicholas Peyret, Charles Scafe, Charles Larry, Michael Rhodes, Trevor Woodage, Xiaoqing You, Lily Xu, Eugene Spier, and Francisco De La Vega. Applied Biosystems, Foster City, CA 94404 SNPlexTM System Human Linkage Mapping Set 4k: A 1.
78 KB 1  


Protocols (9)

Title Size Pages E-mail* Hard Copy*
Applied Biosystems CYP450 Protein Assay - Human Induction Kit
Part #: 4444550 Rev A   

Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.
815 KB 34  
Custom TaqMan® Assays: For New SNP Genotyping and Gene Expression Assays
Part #: 4367671 Rev E   

Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE.
2694 KB 88  
MicroSeq® ID Analysis Software v2.0 Analyst Workflow: Quick Reference Card: Rev A
Part #: 4364624   

MicroSeq® ID Analysis Software Version 2.0 is a tool for microbial identification of bacteria and fungi. The software analyzes data generated using a MicroSeq® chemistry kit and an Applied Biosystems capillary-based genetic analyzer. For information on this product, go to http://www.microseq.com.
836 KB 8  
NanoAmp™ RT-IVT Labeling Kit: RT-IVT Labeling Process for Two Rounds of Amplification: Applied Biosystems Expression Array
Part #: 4370891   

For safety and biohazard guidelines, refer to the “Safety” section in the NanoAmp™ RT-IVT Labeling Kit Protocol (PN 4365710). For all chemicals that appear in bold type throughout this document, read the MSDS and follow the handling instructions.
110 KB 6  
PI sheet AIV-M Controls
Part #: 4412868B   

Materials Provided: Component Amount Storage Xeno™ RNA Control (10,000 copies/μL) 110 μL –20°C 25X AIV-Matrix Control RNA (10,000 copies/μL) 15 μL –20°C Nucleic Acid Dilution Solution 500 μL –20°C Safety Information: Read the MSDS, and follow the handling instructions.
102 KB two    
PI sheet AIV-M Reagents
Part #: 4412867B   

Component Amount Storage 2X RT-PCR Buffer 1.375 mL –20°C 25X RT-PCR Enzyme Mix 110 μL –20°C 25X AIV-Matrix Primer Probe Mix 110 μL –20°C Detection Enhancer 190 μL –20°C Nuclease-free Water 1.75 mL –20°C, 4°C, or room temp
82 KB two    
NanoAmp™ RT-IVT Labeling Kit: RT-IVT Labeling Process for One Round of Amplification: Applied Biosystems Expression Array S
Part #: 4365711   

For safety and biohazard guidelines, refer to the “Safety” section in the NanoAmp™ RT-IVT Labeling Kit Protocol (PN 4365710). For all chemicals that appear in bold type throughout this document, read the MSDS and follow the handling instructions.
86 KB 4  
Running TaqMan® Low Density Arrays on 7900HT Real-Time PCR Systems: Applied Biosystems TaqMan® Low Density Array
Part #: 4371129 Rev A    Stock #: 132UB01-01

This user bulletin describes procedures for using TaqMan Low Density Arrays (TaqMan Arrays) to perform relative quantitation (RQ) of targets using the comparative CT (ddCT) method on Applied Biosystems 7900HT Systems.
894 KB 24  
Resequencing Human Mitochondrial DNA with the mitoSEQr™: Protocol Summary
Stock #: 106PT02-01

• RSS000056016_01 (mitoCR™) for the control region including Hypervariable regions I/II (9 primer pairs) Each primer is tailed with a universal M13 sequence and are designed for universal PCR and Sequencing conditions.
806 KB 2  


References (1)

Title Size Pages E-mail* Hard Copy*
3500 instruments reference list
Stock #: Anjali Pradhan

Authors: Di Nicolantonio F, Martini M, Molinari F, Sartore-Bianchi A, Arena S, Saletti P, De Dosso S, Mazzucchelli L, Frattini M, Siena S, Bardelli A. Cancer Therapy: Clinical BRCA1 genetic testing in 106 breast and ovarian cancer families from southern Italy (Sicily): a mutation analyses
59 KB 4  


Additional Documents (10)

Title Size Pages E-mail* Hard Copy*
EUROPEAN VERSION: Smart Monitoring Service: Increase productivity with real-time remote instrument monitoring: Brochure
Stock #: 121MI22-05

With a combination of remote preemptive monitoring and remote diagnostics, many of our customers are experiencing a significant increase in instrument uptime with the award-winning Smart Monitoring Service. What is Applied Biosystems Smart Monitoring Service?
535 KB 8
AACC Customer Presentation

Detection and identification of unexpected compounds in biological matrices (urine, blood, etc.) Usually performed using combinations of immunoassays, GC-MS, HPLC-DAD, etc. But still perfectible. LC-MS/MS theoretically represents the most universal technique and has been experimented in this aim.
2618 KB 3  
GeneScan and Genotyper Discontinuation Letter
Stock #: 127MI21-02

With the launch of GeneMapper™ Software v3.0 last October, and the development of our new software packages - GeneMapper™ software v3.5 and GeneMapper™ ID software v3.
16 KB 2  
AmpFLSTR® Allelic Ladder Redevelopment Customer Letter

As part of our on-going efforts to consistently provide the highest quality allelic ladders, we have introduced minor, yet important, changes to the allelic ladder manufacturing process.
67 KB 1  
TaqMan® Gene Expression Assays: Miscellaneous
Stock #: 127MI36-03

MGB Probes 4316034 6FAM, VIC, NED™ or TET 6,000 pmol 4316033 6FAM, VIC, NED or TET 20,000 pmol 4316032 6FAM, VIC, NED or TET 50,000 pmol Real-Time PCR Primers 4304970 No label 10,000 pmol (sequence detection primers) 4304971 No label 80,000 pmol 4304972 No label 130,000 pmol TaqMan®
423 KB 2
Integrated sequence-based genotyping of viral populations using the ABI Prism SeqScape Software v2.0 and 3100 Genetic Analzye
Stock #: 127MI16-01

Historically, viral populations have been classified according to their antigenic characteristics, but the advent of rapid and affordabl e protocols and instrumentation has made automated DNA sequence analysis the most reliable and accurate method for evaluation of viral genome variation.
228 KB 1  
A Resequencing primer set for 3,000 genes implicated in cancer genetics: Miscellaneous
Stock #: 127MI15-01

The Applied Biosystems 3730xl and 3730 DNA Analyzers includes patented technology licensed from Hitachi, Ltd. as part of a strategic partnership between Applied Biosystems and Hitachi, Ltd., as well as patented technology of Applied Biosystems. For Research Use Only.
299 KB 1  
Understanding Assay Information Files: Assays-by-Design Service

Your Assays-by-DesignSM order arrives with a CD-ROM. This CD-ROM contains a product insert and an Assay Information File (AIF) that contains information for configuring your LIMS system. The AIF is automatically uploaded from the CD-ROM by your LIMS system. AIF File-Name Conventions
187 KB 6  
Literature List for Applied Biosystems MicroSeq® System

1) Fontana C, Favaro M, Cicchetti O, Minelli S, Pistoia ES, Favalli C. Performance of Strand Displacement Amplification Assay in the Detection of Chlamydia trachomatis and Neisseria gonorrhoeae. Jpn J Infect Dis. 2005 Oct;58(5):283-8. (MicroSeq® 500, ABI PRISM♦ 310 instrument)*
109 KB 5  
About Data Collection v3.1 software: Miscellaneous

Microsoft’s license availability for the Windows 2000 operating system ended in March 2004, leaving Windows XP as the only fully supported operating system. A new version of the 310 Data Collection Software (DC v3.1) is required for XP compatibility. Performance Verification
102 KB 5  


The lock icon Requires Registration indicates a document that requires registration for download.
* Email and/or Hard Copy require registration for document delivery.
ResetDeliver Selected Documents